Release 5.4.0 (Yellow Frog) by jfy133 · Pull Request #970 · nf-core/mag

jfy133 · 2026-01-26T13:20:19Z

PR checklist

Co-authored-by: Daniel Straub <[email protected]>

Post 5.3.0 release version bump

… DASTool inputs

Ale module

Update utils_nfschema_pipeline to allow `--help`

Co-authored-by: Daniel Straub <[email protected]>

Bump version for release 5.4

github-actions · 2026-01-26T13:22:54Z

`nf-core pipelines lint` overall result: Passed ✅ ⚠️

Posted for pipeline commit 223ef48

+| ✅ 382 tests passed       |+
#| ❔   1 tests were ignored |#
!| ❗   7 tests had warnings |!

Details

❗ Test warnings:

nextflow_config - Config manifest.version should end in dev: 5.4.0
pipeline_todos - TODO string in main.nf: Remove this line if you don't need a FASTA file [TODO: try and test using for --host_fasta and --host_genome]
pipeline_todos - TODO string in methods_description_template.yml: #Update the HTML below to your preferred methods description, e.g. add publication citation for this pipeline
pipeline_todos - TODO string in main.nf: Optionally add in-text citation tools to this list.
pipeline_todos - TODO string in main.nf: Optionally add bibliographic entries to this list.
pipeline_todos - TODO string in main.nf: Only uncomment below if logic in toolCitationText/toolBibliographyText has been filled!
pipeline_todos - TODO string in nextflow.config: Specify any additional parameters here

❔ Tests ignored:

files_unchanged - File ignored due to lint config: .github/PULL_REQUEST_TEMPLATE.md

✅ Tests passed:

files_exist - File found: .gitattributes
files_exist - File found: .gitignore
files_exist - File found: .nf-core.yml
files_exist - File found: .prettierignore
files_exist - File found: .prettierrc.yml
files_exist - File found: CHANGELOG.md
files_exist - File found: CITATIONS.md
files_exist - File found: CODE_OF_CONDUCT.md
files_exist - File found: LICENSE or LICENSE.md or LICENCE or LICENCE.md
files_exist - File found: nextflow_schema.json
files_exist - File found: nextflow.config
files_exist - File found: README.md
files_exist - File found: .github/.dockstore.yml
files_exist - File found: .github/CONTRIBUTING.md
files_exist - File found: .github/ISSUE_TEMPLATE/bug_report.yml
files_exist - File found: .github/ISSUE_TEMPLATE/config.yml
files_exist - File found: .github/ISSUE_TEMPLATE/feature_request.yml
files_exist - File found: .github/PULL_REQUEST_TEMPLATE.md
files_exist - File found: .github/workflows/branch.yml
files_exist - File found: .github/workflows/nf-test.yml
files_exist - File found: .github/actions/get-shards/action.yml
files_exist - File found: .github/actions/nf-test/action.yml
files_exist - File found: .github/workflows/linting_comment.yml
files_exist - File found: .github/workflows/linting.yml
files_exist - File found: assets/email_template.html
files_exist - File found: assets/email_template.txt
files_exist - File found: assets/sendmail_template.txt
files_exist - File found: assets/nf-core-mag_logo_light.png
files_exist - File found: conf/modules.config
files_exist - File found: conf/test.config
files_exist - File found: conf/test_full.config
files_exist - File found: docs/images/nf-core-mag_logo_light.png
files_exist - File found: docs/images/nf-core-mag_logo_dark.png
files_exist - File found: docs/output.md
files_exist - File found: docs/README.md
files_exist - File found: docs/README.md
files_exist - File found: docs/usage.md
files_exist - File found: nf-test.config
files_exist - File found: tests/default.nf.test
files_exist - File found: main.nf
files_exist - File found: assets/multiqc_config.yml
files_exist - File found: conf/base.config
files_exist - File found: conf/igenomes.config
files_exist - File found: conf/igenomes_ignored.config
files_exist - File found: .github/workflows/awstest.yml
files_exist - File found: .github/workflows/awsfulltest.yml
files_exist - File found: modules.json
files_exist - File found: ro-crate-metadata.json
files_exist - File not found check: .github/ISSUE_TEMPLATE/bug_report.md
files_exist - File not found check: .github/ISSUE_TEMPLATE/feature_request.md
files_exist - File not found check: .github/workflows/push_dockerhub.yml
files_exist - File not found check: .markdownlint.yml
files_exist - File not found check: .nf-core.yaml
files_exist - File not found check: .yamllint.yml
files_exist - File not found check: bin/markdown_to_html.r
files_exist - File not found check: conf/aws.config
files_exist - File not found check: docs/images/nf-core-mag_logo.png
files_exist - File not found check: lib/Checks.groovy
files_exist - File not found check: lib/Completion.groovy
files_exist - File not found check: lib/NfcoreTemplate.groovy
files_exist - File not found check: lib/Utils.groovy
files_exist - File not found check: lib/Workflow.groovy
files_exist - File not found check: lib/WorkflowMain.groovy
files_exist - File not found check: lib/WorkflowMag.groovy
files_exist - File not found check: parameters.settings.json
files_exist - File not found check: pipeline_template.yml
files_exist - File not found check: Singularity
files_exist - File not found check: lib/nfcore_external_java_deps.jar
files_exist - File not found check: .travis.yml
nextflow_config - Found nf-schema plugin
nextflow_config - Config variable found: manifest.name
nextflow_config - Config variable found: manifest.nextflowVersion
nextflow_config - Config variable found: manifest.description
nextflow_config - Config variable found: manifest.version
nextflow_config - Config variable found: manifest.homePage
nextflow_config - Config variable found: timeline.enabled
nextflow_config - Config variable found: trace.enabled
nextflow_config - Config variable found: report.enabled
nextflow_config - Config variable found: dag.enabled
nextflow_config - Config variable found: process.cpus
nextflow_config - Config variable found: process.memory
nextflow_config - Config variable found: process.time
nextflow_config - Config variable found: params.outdir
nextflow_config - Config variable found: params.input
nextflow_config - Config variable found: manifest.mainScript
nextflow_config - Config variable found: timeline.file
nextflow_config - Config variable found: trace.file
nextflow_config - Config variable found: report.file
nextflow_config - Config variable found: dag.file
nextflow_config - Config variable (correctly) not found: params.nf_required_version
nextflow_config - Config variable (correctly) not found: params.container
nextflow_config - Config variable (correctly) not found: params.singleEnd
nextflow_config - Config variable (correctly) not found: params.igenomesIgnore
nextflow_config - Config variable (correctly) not found: params.name
nextflow_config - Config variable (correctly) not found: params.enable_conda
nextflow_config - Config variable (correctly) not found: params.max_cpus
nextflow_config - Config variable (correctly) not found: params.max_memory
nextflow_config - Config variable (correctly) not found: params.max_time
nextflow_config - Config variable (correctly) not found: params.validationFailUnrecognisedParams
nextflow_config - Config variable (correctly) not found: params.validationLenientMode
nextflow_config - Config variable (correctly) not found: params.validationSchemaIgnoreParams
nextflow_config - Config variable (correctly) not found: params.validationShowHiddenParams
nextflow_config - Config variable (correctly) not found: validation.failUnrecognisedParams
nextflow_config - Config variable (correctly) not found: validation.failUnrecognisedHeaders
nextflow_config - Config timeline.enabled had correct value: true
nextflow_config - Config report.enabled had correct value: true
nextflow_config - Config trace.enabled had correct value: true
nextflow_config - Config dag.enabled had correct value: true
nextflow_config - Config manifest.name began with nf-core/
nextflow_config - Config variable manifest.homePage began with https://github.com/nf-core/
nextflow_config - Config dag.file ended with .html
nextflow_config - Config variable manifest.nextflowVersion started with >= or !>=
nextflow_config - Config params.custom_config_version is set to master
nextflow_config - Config params.custom_config_base is set to https://raw.githubusercontent.com/nf-core/configs/master
nextflow_config - Lines for loading custom profiles found
nextflow_config - nextflow.config contains configuration profile test
nextflow_config - Config default value correct: params.igenomes_base= s3://ngi-igenomes/igenomes/
nextflow_config - Config default value correct: params.custom_config_version= master
nextflow_config - Config default value correct: params.custom_config_base= https://raw.githubusercontent.com/nf-core/configs/master
nextflow_config - Config default value correct: params.publish_dir_mode= copy
nextflow_config - Config default value correct: params.max_multiqc_email_size= 25.MB
nextflow_config - Config default value correct: params.validate_params= true
nextflow_config - Config default value correct: params.pipelines_testdata_base_path= https://raw.githubusercontent.com/nf-core/test-datasets/
nextflow_config - Config default value correct: params.spades_fix_cpus= -1
nextflow_config - Config default value correct: params.spadeshybrid_fix_cpus= -1
nextflow_config - Config default value correct: params.metabat_rng_seed= 1
nextflow_config - Config default value correct: params.clip_tool= fastp
nextflow_config - Config default value correct: params.reads_minlength= 15
nextflow_config - Config default value correct: params.fastp_qualified_quality= 15
nextflow_config - Config default value correct: params.fastp_cut_mean_quality= 15
nextflow_config - Config default value correct: params.adapterremoval_minquality= 2
nextflow_config - Config default value correct: params.adapterremoval_adapter1= AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG
nextflow_config - Config default value correct: params.adapterremoval_adapter2= AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT
nextflow_config - Config default value correct: params.bbnorm_target= 100
nextflow_config - Config default value correct: params.bbnorm_min= 5
nextflow_config - Config default value correct: params.longreads_min_length= 1000
nextflow_config - Config default value correct: params.longreads_keep_percent= 90
nextflow_config - Config default value correct: params.longreads_length_weight= 10
nextflow_config - Config default value correct: params.longread_adaptertrimming_tool= porechop_abi
nextflow_config - Config default value correct: params.longread_filtering_tool= filtlong
nextflow_config - Config default value correct: params.gtdb_db= https://data.gtdb.aau.ecogenomic.org/releases/release226/226.0/auxillary_files/gtdbtk_package/full_package/gtdbtk_r226_data.tar.gz
nextflow_config - Config default value correct: params.gtdbtk_min_completeness= 50.0
nextflow_config - Config default value correct: params.gtdbtk_max_contamination= 10.0
nextflow_config - Config default value correct: params.gtdbtk_min_perc_aa= 10.0
nextflow_config - Config default value correct: params.gtdbtk_min_af= 0.65
nextflow_config - Config default value correct: params.gtdbtk_pplacer_cpus= 1
nextflow_config - Config default value correct: params.spades_downstreaminput= scaffolds
nextflow_config - Config default value correct: params.genomad_min_score= 0.7
nextflow_config - Config default value correct: params.genomad_splits= 1
nextflow_config - Config default value correct: params.binning_map_mode= group
nextflow_config - Config default value correct: params.bin_metabinner_scale= large
nextflow_config - Config default value correct: params.semibin_rng_seed= 1
nextflow_config - Config default value correct: params.semibin_environment= global
nextflow_config - Config default value correct: params.min_contig_size= 1500
nextflow_config - Config default value correct: params.min_length_unbinned_contigs= 1000000
nextflow_config - Config default value correct: params.max_unbinned_contigs= 100
nextflow_config - Config default value correct: params.bin_min_size= 0
nextflow_config - Config default value correct: params.bin_concoct_chunksize= 10000
nextflow_config - Config default value correct: params.bin_concoct_overlap= 0
nextflow_config - Config default value correct: params.bin_domain_classification_tool= tiara
nextflow_config - Config default value correct: params.tiara_min_length= 3000
nextflow_config - Config default value correct: params.busco_db_lineage= auto
nextflow_config - Config default value correct: params.checkm_download_url= https://zenodo.org/records/7401545/files/checkm_data_2015_01_16.tar.gz
nextflow_config - Config default value correct: params.checkm2_db_version= 14897628
nextflow_config - Config default value correct: params.refine_bins_dastool_threshold= 0.5
nextflow_config - Config default value correct: params.postbinning_input= raw_bins_only
nextflow_config - Config default value correct: params.gunc_database_type= progenomes
nextflow_config - Config default value correct: params.pydamage_accuracy= 0.5
nextflow_config - Config default value correct: params.freebayes_ploidy= 1
nextflow_config - Config default value correct: params.freebayes_min_basequality= 20
nextflow_config - Config default value correct: params.freebayes_minallelefreq= 0.33
nextflow_config - Config default value correct: params.bcftools_view_high_variant_quality= 30
nextflow_config - Config default value correct: params.bcftools_view_medium_variant_quality= 20
nextflow_config - Config default value correct: params.bcftools_view_minimal_allelesupport= 3
nf_test_content - 'tests/test_single_end.nf.test' contains outdir parameter
nf_test_content - 'tests/test_single_end.nf.test' snapshots a 'versions.yml' file
nf_test_content - 'tests/test_single_end.nf.test' snapshots a 'versions.yml' file
nf_test_content - 'tests/default.nf.test' contains outdir parameter
nf_test_content - 'tests/default.nf.test' snapshots a 'versions.yml' file
nf_test_content - 'tests/default.nf.test' snapshots a 'versions.yml' file
nf_test_content - 'tests/test_hybrid.nf.test' contains outdir parameter
nf_test_content - 'tests/test_hybrid.nf.test' snapshots a 'versions.yml' file
nf_test_content - 'tests/test_hybrid.nf.test' snapshots a 'versions.yml' file
nf_test_content - 'tests/test_minimal.nf.test' contains outdir parameter
nf_test_content - 'tests/test_minimal.nf.test' snapshots a 'versions.yml' file
nf_test_content - 'tests/test_minimal.nf.test' snapshots a 'versions.yml' file
nf_test_content - 'tests/test_assembly_input.nf.test' contains outdir parameter
nf_test_content - 'tests/test_assembly_input.nf.test' snapshots a 'versions.yml' file
nf_test_content - 'tests/test_longreadonly.nf.test' contains outdir parameter
nf_test_content - 'tests/test_longreadonly.nf.test' snapshots a 'versions.yml' file
nf_test_content - 'tests/test_longreadonly.nf.test' snapshots a 'versions.yml' file
nf_test_content - 'tests/test_longreadonly_alternatives.nf.test' contains outdir parameter
nf_test_content - 'tests/test_longreadonly_alternatives.nf.test' snapshots a 'versions.yml' file
nf_test_content - 'tests/test_longreadonly_alternatives.nf.test' snapshots a 'versions.yml' file
nf_test_content - 'tests/test_alternatives.nf.test' contains outdir parameter
nf_test_content - 'tests/test_alternatives.nf.test' snapshots a 'versions.yml' file
nf_test_content - 'tests/nextflow.config' contains modules_testdata_base_path
nf_test_content - 'tests/nextflow.config' contains pipelines_testdata_base_path
nf_test_content - 'nf-test.config' sets a testsDir
nf_test_content - 'nf-test.config' sets a workDir
nf_test_content - 'nf-test.config' sets a configFile
files_unchanged - .gitattributes matches the template
files_unchanged - .prettierrc.yml matches the template
files_unchanged - CODE_OF_CONDUCT.md matches the template
files_unchanged - LICENSE matches the template
files_unchanged - .github/.dockstore.yml matches the template
files_unchanged - .github/CONTRIBUTING.md matches the template
files_unchanged - .github/ISSUE_TEMPLATE/bug_report.yml matches the template
files_unchanged - .github/ISSUE_TEMPLATE/config.yml matches the template
files_unchanged - .github/ISSUE_TEMPLATE/feature_request.yml matches the template
files_unchanged - .github/workflows/branch.yml matches the template
files_unchanged - .github/workflows/linting_comment.yml matches the template
files_unchanged - .github/workflows/linting.yml matches the template
files_unchanged - assets/email_template.html matches the template
files_unchanged - assets/email_template.txt matches the template
files_unchanged - assets/sendmail_template.txt matches the template
files_unchanged - assets/nf-core-mag_logo_light.png matches the template
files_unchanged - docs/images/nf-core-mag_logo_light.png matches the template
files_unchanged - docs/images/nf-core-mag_logo_dark.png matches the template
files_unchanged - docs/README.md matches the template
files_unchanged - .gitignore matches the template
files_unchanged - .prettierignore matches the template
actions_nf_test - '.github/workflows/nf-test.yml' is triggered on expected events
actions_nf_test - '.github/workflows/nf-test.yml' checks minimum NF version
actions_awstest - '.github/workflows/awstest.yml' is triggered correctly
actions_awsfulltest - .github/workflows/awsfulltest.yml is triggered correctly
actions_awsfulltest - .github/workflows/awsfulltest.yml does not use -profile test
readme - README Nextflow minimum version badge matched config. Badge: 25.04.2, Config: 25.04.2
readme - README nf-core template version badge found.
readme - README Zenodo placeholder was replaced with DOI.
pipeline_if_empty_null - No ifEmpty(null) strings found
plugin_includes - No wrong validation plugin imports have been found
pipeline_name_conventions - Name adheres to nf-core convention
template_strings - Did not find any Jinja template strings (0 files)
schema_lint - Schema lint passed
schema_lint - Schema title + description lint passed
schema_lint - Input mimetype lint passed: 'text/csv'
schema_params - Schema matched params returned from nextflow config
system_exit - No System.exit calls found
actions_schema_validation - Workflow validation passed: linting.yml
actions_schema_validation - Workflow validation passed: download_pipeline.yml
actions_schema_validation - Workflow validation passed: template-version-comment.yml
actions_schema_validation - Workflow validation passed: linting_comment.yml
actions_schema_validation - Workflow validation passed: release-announcements.yml
actions_schema_validation - Workflow validation passed: labeler.yml
actions_schema_validation - Workflow validation passed: fix_linting.yml
actions_schema_validation - Workflow validation passed: nf-test.yml
actions_schema_validation - Workflow validation passed: awsfulltest.yml
actions_schema_validation - Workflow validation passed: branch.yml
actions_schema_validation - Workflow validation passed: awstest.yml
actions_schema_validation - Workflow validation passed: clean-up.yml
merge_markers - No merge markers found in pipeline files
modules_json - Only installed modules found in modules.json
multiqc_config - assets/multiqc_config.yml found and not ignored.
multiqc_config - assets/multiqc_config.yml contains report_section_order
multiqc_config - assets/multiqc_config.yml contains export_plots
multiqc_config - assets/multiqc_config.yml contains report_comment
multiqc_config - assets/multiqc_config.yml follows the ordering scheme of the minimally required plugins.
multiqc_config - assets/multiqc_config.yml contains a matching 'report_comment'.
multiqc_config - assets/multiqc_config.yml contains 'export_plots: true'.
modules_structure - modules directory structure is correct 'modules/nf-core/TOOL/SUBTOOL'
local_component_structure - local subworkflows directory structure is correct 'subworkflows/local/TOOL/SUBTOOL'
base_config - conf/base.config found and not ignored.
base_config - BOWTIE2_HOST_REMOVAL_BUILD found in conf/base.config and Nextflow scripts.
base_config - BOWTIE2_HOST_REMOVAL_ALIGN found in conf/base.config and Nextflow scripts.
base_config - BOWTIE2_PHIX_REMOVAL_ALIGN found in conf/base.config and Nextflow scripts.
base_config - PORECHOP_PORECHOP found in conf/base.config and Nextflow scripts.
base_config - NANOLYSE found in conf/base.config and Nextflow scripts.
base_config - FILTLONG found in conf/base.config and Nextflow scripts.
base_config - CATPACK_BINS found in conf/base.config and Nextflow scripts.
base_config - CATPACK_CONTIGS found in conf/base.config and Nextflow scripts.
base_config - GTDBTK_CLASSIFYWF found in conf/base.config and Nextflow scripts.
base_config - MEGAHIT found in conf/base.config and Nextflow scripts.
base_config - METASPADES found in conf/base.config and Nextflow scripts.
base_config - METASPADESHYBRID found in conf/base.config and Nextflow scripts.
base_config - METAMDBG_ASM found in conf/base.config and Nextflow scripts.
base_config - FLYE found in conf/base.config and Nextflow scripts.
base_config - BOWTIE2_ASSEMBLY_ALIGN found in conf/base.config and Nextflow scripts.
base_config - METABAT2_METABAT2 found in conf/base.config and Nextflow scripts.
base_config - MAG_DEPTHS found in conf/base.config and Nextflow scripts.
base_config - MAG_DEPTHS_PLOT found in conf/base.config and Nextflow scripts.
base_config - BUSCO_BUSCO found in conf/base.config and Nextflow scripts.
base_config - MAXBIN2 found in conf/base.config and Nextflow scripts.
base_config - COMEBIN_RUNCOMEBIN found in conf/base.config and Nextflow scripts.
base_config - METABINNER_METABINNER found in conf/base.config and Nextflow scripts.
base_config - DASTOOL_DASTOOL found in conf/base.config and Nextflow scripts.
base_config - CHECKM_LINEAGEWF found in conf/base.config and Nextflow scripts.
base_config - CHECKM2_PREDICT found in conf/base.config and Nextflow scripts.
modules_config - conf/modules.config found and not ignored.
modules_config - FASTQC_RAW found in conf/modules.config and Nextflow scripts.
modules_config - FASTP found in conf/modules.config and Nextflow scripts.
modules_config - TRIMMOMATIC found in conf/modules.config and Nextflow scripts.
modules_config - ADAPTERREMOVAL_PE found in conf/modules.config and Nextflow scripts.
modules_config - ADAPTERREMOVAL_SE found in conf/modules.config and Nextflow scripts.
modules_config - BOWTIE2_PHIX_REMOVAL_ALIGN found in conf/modules.config and Nextflow scripts.
modules_config - BOWTIE2_HOST_REMOVAL_ALIGN found in conf/modules.config and Nextflow scripts.
modules_config - FASTQC_TRIMMED found in conf/modules.config and Nextflow scripts.
modules_config - BBMAP_BBNORM found in conf/modules.config and Nextflow scripts.
modules_config - PORECHOP_PORECHOP found in conf/modules.config and Nextflow scripts.
modules_config - PORECHOP_ABI found in conf/modules.config and Nextflow scripts.
modules_config - FILTLONG found in conf/modules.config and Nextflow scripts.
modules_config - NANOQ found in conf/modules.config and Nextflow scripts.
modules_config - NANOLYSE found in conf/modules.config and Nextflow scripts.
modules_config - CHOPPER found in conf/modules.config and Nextflow scripts.
modules_config - NANOPLOT_RAW found in conf/modules.config and Nextflow scripts.
modules_config - NANOPLOT_FILTERED found in conf/modules.config and Nextflow scripts.
modules_config - MINIMAP2_HOST_INDEX found in conf/modules.config and Nextflow scripts.
modules_config - MINIMAP2_HOST_ALIGN found in conf/modules.config and Nextflow scripts.
modules_config - MINIMAP2_ASSEMBLY_ALIGN found in conf/modules.config and Nextflow scripts.
modules_config - SAMTOOLS_HOSTREMOVED_UNMAPPED found in conf/modules.config and Nextflow scripts.
modules_config - SAMTOOLS_HOSTREMOVED_STATS found in conf/modules.config and Nextflow scripts.
modules_config - MEGAHIT found in conf/modules.config and Nextflow scripts.
modules_config - METASPADES found in conf/modules.config and Nextflow scripts.
modules_config - METASPADESHYBRID found in conf/modules.config and Nextflow scripts.
modules_config - FLYE found in conf/modules.config and Nextflow scripts.
modules_config - METAMDBG_ASM found in conf/modules.config and Nextflow scripts.
modules_config - QUAST found in conf/modules.config and Nextflow scripts.
modules_config - ALE found in conf/modules.config and Nextflow scripts.
modules_config - QUAST_BINS found in conf/modules.config and Nextflow scripts.
modules_config - GENOMAD_ENDTOEND found in conf/modules.config and Nextflow scripts.
modules_config - BOWTIE2_ASSEMBLY_ALIGN found in conf/modules.config and Nextflow scripts.
modules_config - MAG_DEPTHS_PLOT found in conf/modules.config and Nextflow scripts.
modules_config - BIN_SUMMARY found in conf/modules.config and Nextflow scripts.
modules_config - BUSCO_UNTAR found in conf/modules.config and Nextflow scripts.
modules_config - BUSCO_BUSCO found in conf/modules.config and Nextflow scripts.
modules_config - CHECKM_UNTAR found in conf/modules.config and Nextflow scripts.
modules_config - CHECKM_LINEAGEWF found in conf/modules.config and Nextflow scripts.
modules_config - CHECKM_QA found in conf/modules.config and Nextflow scripts.
modules_config - CONCAT_BUSCO_TSV found in conf/modules.config and Nextflow scripts.
modules_config - CHECKM2_DATABASEDOWNLOAD found in conf/modules.config and Nextflow scripts.
modules_config - CHECKM2_PREDICT found in conf/modules.config and Nextflow scripts.
modules_config - GUNC_DOWNLOADDB found in conf/modules.config and Nextflow scripts.
modules_config - GUNC_RUN found in conf/modules.config and Nextflow scripts.
modules_config - GUNC_MERGECHECKM found in conf/modules.config and Nextflow scripts.
modules_config - CATPACK_PREPARE found in conf/modules.config and Nextflow scripts.
modules_config - CATPACK_BINS found in conf/modules.config and Nextflow scripts.
modules_config - CATPACK_ADDNAMES_BINS found in conf/modules.config and Nextflow scripts.
modules_config - CATPACK_SUMMARISE_BINS found in conf/modules.config and Nextflow scripts.
modules_config - CATPACK_UNBINS found in conf/modules.config and Nextflow scripts.
modules_config - CATPACK_ADDNAMES_UNBINS found in conf/modules.config and Nextflow scripts.
modules_config - CATPACK_SUMMARISE_UNBINS found in conf/modules.config and Nextflow scripts.
modules_config - GTDBTK_CLASSIFYWF found in conf/modules.config and Nextflow scripts.
modules_config - GTDBTK_SUMMARY found in conf/modules.config and Nextflow scripts.
modules_config - PROKKA found in conf/modules.config and Nextflow scripts.
modules_config - PRODIGAL found in conf/modules.config and Nextflow scripts.
modules_config - FREEBAYES found in conf/modules.config and Nextflow scripts.
modules_config - BCFTOOLS_VIEW found in conf/modules.config and Nextflow scripts.
modules_config - BCFTOOLS_CONSENSUS found in conf/modules.config and Nextflow scripts.
modules_config - BCFTOOLS_INDEX found in conf/modules.config and Nextflow scripts.
modules_config - PYDAMAGE_ANALYZE found in conf/modules.config and Nextflow scripts.
modules_config - PYDAMAGE_FILTER found in conf/modules.config and Nextflow scripts.
modules_config - SUMMARISE_PYDAMAGEBINS found in conf/modules.config and Nextflow scripts.
modules_config - SAMTOOLS_FAIDX found in conf/modules.config and Nextflow scripts.
modules_config - METABAT2_JGISUMMARIZEBAMCONTIGDEPTHS_SHORTREAD found in conf/modules.config and Nextflow scripts.
modules_config - METABAT2_JGISUMMARIZEBAMCONTIGDEPTHS_LONGREAD found in conf/modules.config and Nextflow scripts.
modules_config - METABAT2_METABAT2 found in conf/modules.config and Nextflow scripts.
modules_config - MAXBIN2 found in conf/modules.config and Nextflow scripts.
modules_config - ADJUST_MAXBIN2_EXT found in conf/modules.config and Nextflow scripts.
modules_config - CONCOCT_CUTUPFASTA found in conf/modules.config and Nextflow scripts.
modules_config - CONCOCT_ found in conf/modules.config and Nextflow scripts.
modules_config - COMEBIN_RUNCOMEBIN found in conf/modules.config and Nextflow scripts.
modules_config - METABINNER_KMER found in conf/modules.config and Nextflow scripts.
modules_config - METABINNER_TOOSHORT found in conf/modules.config and Nextflow scripts.
modules_config - METABINNER_METABINNER found in conf/modules.config and Nextflow scripts.
modules_config - METABINNER_BINS found in conf/modules.config and Nextflow scripts.
modules_config - SEMIBIN_SINGLEEASYBIN found in conf/modules.config and Nextflow scripts.
modules_config - SEQKIT_STATS found in conf/modules.config and Nextflow scripts.
modules_config - SPLIT_FASTA found in conf/modules.config and Nextflow scripts.
modules_config - DASTOOL_FASTATOCONTIG2BIN_TIARA found in conf/modules.config and Nextflow scripts.
modules_config - DASTOOL_FASTATOCONTIG2BIN found in conf/modules.config and Nextflow scripts.
modules_config - DASTOOL_DASTOOL found in conf/modules.config and Nextflow scripts.
modules_config - RENAME_POSTDASTOOL found in conf/modules.config and Nextflow scripts.
modules_config - TIARA_TIARA found in conf/modules.config and Nextflow scripts.
modules_config - TIARA_CLASSIFY found in conf/modules.config and Nextflow scripts.
modules_config - CONCAT_TIARA_TSV found in conf/modules.config and Nextflow scripts.
modules_config - MMSEQS_DATABASES found in conf/modules.config and Nextflow scripts.
modules_config - METAEUK_EASYPREDICT found in conf/modules.config and Nextflow scripts.
modules_config - MULTIQC found in conf/modules.config and Nextflow scripts.
modules_config - BIGMAG found in conf/modules.config and Nextflow scripts.
nfcore_yml - Repository type in .nf-core.yml is valid: pipeline
nfcore_yml - nf-core version in .nf-core.yml is set to the latest version: 3.5.1
rocrate_readme_sync - RO-Crate descriptions are in sync with README.md.

Run details

nf-core/tools version 3.5.1
Run at 2026-02-02 11:16:59

ggabernet

Looks good to me, just a couple of tests seem not to be passing with singularity

charles-plessy

The changes look good to me and @takiifujita-ui. We did not proofread the python code in details.

…ta-ui

…ta-ui

…itted with bins

nf-core-bot · 2026-02-02T09:27:42Z

Warning

Newer version of the nf-core template is available.

Your pipeline is using an old version of the nf-core template: 3.5.1.
Please update your pipeline to the latest version.

For more documentation on how to update your pipeline, please see the nf-core documentation and Synchronisation documentation.

Add PR labeller workflow to report size of PRs

jfy133 · 2026-02-02T13:35:39Z

Final issue is due to

  [f8/066e9b] Submitted process > NFCORE_MAG:MAG:ASSEMBLY:POOL_SHORT_READS (group-0)
  [cd/35613a] Submitted process > NFCORE_MAG:MAG:ASSEMBLY:SHORTREAD_ASSEMBLY:MEGAHIT (group-0)
  ERROR ~ No such file or directory: https://zenodo.org/records/14897628/files/checkm2_database.tar.gz

Which I am replicating locally when running with conda and nf-test. This is is nothing we can do about currently as per https://blog.zenodo.org/2026/01/28/2026-01-28-improvements-and-support-expectations/

See https://nfcore.slack.com/archives/C04QR0T3G3H/p1770036127541799: We pushed a patch-release for nf-core tools (3.5.2) without any template changes. Unfortunately, this still results in the outdated comment being added to your PRs, e.g., nf-core/mag#970 (comment). Sorry, for that. Either ignore them or just update the nf-core version in .nf-core.yml to 3.5.2

PetcuBogdan and others added 30 commits October 23, 2025 10:13

Add ale module and call ale from mag.nf

0eeb3df

add ale result output path

785e7f4

minor improvements

3779476

Merge branch 'nf-core:main' into ale_module

db0ea09

update changelog.md and usage.md

611182a

[automated] Fix code linting

d0a489d

fix duplicate from usage.md

fd550b7

Co-authored-by: Daniel Straub <[email protected]>

fix misspelled from nextflow_schema

ce4298c

Co-authored-by: Daniel Straub <[email protected]>

fix small problems

1c71558

Add summarise pydamage bins module and store making script

69c35e6

run BINNING_PREPARATION for ale

5767e89

Post release bump

bbaf119

Update snaphot version

91fe6e4

Merge pull request #957 from dialvarezs/post-release-bump

652940b

Post 5.3.0 release version bump

Merge branch 'nf-core:main' into ale_module

ab6e7c8

exclude ale from the tests with test data

91dc3f7

Merge remote-tracking branch 'upstream/dev' into ale_module

cfba4c8

Update changelog

1afe0c7

updated schema and enable ale in test.config

f7131b2

ext.prefix for FASTATOCONTIG2BIN for SemiBin2/MetaBinner

b5a6ca5

updated BINNING_REFINEMENT workflow to include MetaBinner/SemiBin2 as…

c16a52d

… DASTool inputs

Update CHANGELOG.md

323da79

oops, a typo

bfb7164

snapshot update

1cdfc9d

snapshot update....again

164d2b0

Get basic scripts working

c0285a1

Save 'raw' files of the reordered contigs per bin

9b4af4e

Update tests and improve docs

87a8e1a

Merge branch 'dev' into merge-binqc-pydamage-2

f9c162f

update CHANGELOG

2cef3eb

dialvarezs and others added 8 commits January 22, 2026 09:16

Add ALE to pipeline summary

6e92cab

Merge pull request #931 from PetcuBogdan/ale_module

ee13a46

Ale module

Update tuils_nfcore_pipeline

63468a1

Merge pull request #967 from nf-core/update-utils-subworkflow

3cbc2a6

Update utils_nfschema_pipeline to allow `--help`

Version bump for release

909d9ce

Bump versios in tests

01323b4

Update CHANGELOG.md

b9e5562

Co-authored-by: Daniel Straub <[email protected]>

Merge pull request #969 from nf-core/bump-version-release-5.4

63ecfcf

Bump version for release 5.4

jfy133 marked this pull request as ready for review January 26, 2026 13:20

jfy133 requested review from d4straub, dialvarezs, muabnezor and prototaxites as code owners January 26, 2026 13:20

ggabernet approved these changes Jan 27, 2026

View reviewed changes

charles-plessy approved these changes Jan 27, 2026

View reviewed changes

Comment thread subworkflows/local/binning_pydamage/meta.yml

jfy133 added 6 commits January 29, 2026 15:23

Fix file extension based on review from @charles-plessyand @takiifuji…

05298fc

…ta-ui

Update METABAT2 module prevent input assemblies being modified and em…

584513a

…itted with bins

Update release date for v5.4.0 in CHANGELOG

db4c055

Remove no-longer needed versions mixing for metabat2

5c80a77

Merge branch 'dev' of github.com:nf-core/mag into dev

0a20f5d

Add longer singularity pullTimeout for DasTool

cbd52c3

jfy133 and others added 3 commits February 2, 2026 12:07

Add PR labeller workflow

a9daeb3

[automated] Fix code linting

ca45d13

Merge pull request #972 from nf-core/add-pr-labeller-workflow

223ef48

Add PR labeller workflow to report size of PRs

github-actions Bot added the size/xl label Feb 2, 2026

jfy133 merged commit b52fa53 into main Feb 2, 2026
150 of 157 checks passed

Provide feedback

Saved searches

Use saved searches to filter your results more quickly

Release 5.4.0 (Yellow Frog)#970

Release 5.4.0 (Yellow Frog)#970
jfy133 merged 91 commits intomainfrom
dev

jfy133 commented Jan 26, 2026

Uh oh!

github-actions Bot commented Jan 26, 2026 •

edited

Loading

❗ Test warnings:

❔ Tests ignored:

✅ Tests passed:

Run details

Uh oh!

ggabernet left a comment

Uh oh!

charles-plessy left a comment

Uh oh!

Uh oh!

nf-core-bot commented Feb 2, 2026

Uh oh!

jfy133 commented Feb 2, 2026

Uh oh!

Uh oh!

Reviewers

Assignees

Labels

Projects

Milestone

Development

Uh oh!

7 participants

Conversation

jfy133 commented Jan 26, 2026

PR checklist

Uh oh!

github-actions Bot commented Jan 26, 2026 • edited Loading Uh oh! There was an error while loading. Please reload this page.

Uh oh!

nf-core pipelines lint overall result: Passed ✅ ⚠️

❗ Test warnings:

❔ Tests ignored:

✅ Tests passed:

Run details

Uh oh!

ggabernet left a comment

Choose a reason for hiding this comment

Uh oh!

charles-plessy left a comment

Choose a reason for hiding this comment

Uh oh!

Uh oh!

nf-core-bot commented Feb 2, 2026

Uh oh!

jfy133 commented Feb 2, 2026

Uh oh!

Uh oh!

Reviewers

Assignees

Labels

Projects

Milestone

Development

Uh oh!

7 participants

github-actions Bot commented Jan 26, 2026 •

edited

Loading

`nf-core pipelines lint` overall result: Passed ✅ ⚠️