Release: v5.2.0 Puce Pangolin by dialvarezs · Pull Request #914 · nf-core/mag

dialvarezs · 2025-11-05T12:25:11Z

Running multiple bin QC tools is now possible, a new binner (MetaBinner) and several bug fixes.

`Added`

#842 - Add support for running multiple binQC tools in one run using dedicated --run_busco, --run_checkm, and --run_checkm2 parameters (by @harper357, with contributions from @dialvarezs, @prototaxites and @jfy133)
#881 - Add binner MetaBinner (by @d4straub, insprired by @HeshamAlmessady & @AlphaSquad)

`Changed`

#842 - Change bin_summary.tsv format for improved clarity and more comprehensiveness (by @harper357, with contributions from @dialvarezs, @prototaxites and @jfy133)
- Now will include columns from all bin QC tools executed in a given run (i.e., all/any of BUSCO, CheckM and CheckM2)
- Adds suffixes to all columns (_<toolname>) to distinguish which column comes from which tool

`Fixed`

#896 - Remove obsolete execution command from README (by @dialvarezs)
#907 - Include refined bins from all binners in the DASTool/bins output folder (by @AlexHoratio)
#911 - Ensure column order is consistent when generating depth summaries to prevent swapped results on merged depth summary (by @dialvarezs)
#912 - Fix validation of multiple sequencing platforms when using binning_map_mode = "all" (reported by @mjfi2sb3, fix by @dialvarezs)
#921 - Fix publishing of BUSCO files (reported by @joao1980, fix by @dialvarezs)

`Dependencies`

Tool	Previous version	New version
MetaBinner		1.4.4-0

`Deprecated`

#842 - Remove --binqc_tool (by @harper357, with contributions from @dialvarezs, @prototaxites and @jfy133)

PR checklist

…invocation for consistency

Co-authored-by: Jim Downie <[email protected]>

…se assign to `mode:` accroding to Nextflow LSP

@mahesh-panchal

…resuming according to @mahesh-panchal

@mahesh-panchal

…ss with resuming according to @mahesh-panchal" This reverts commit 4a1d438.

@mahesh-panchal

…mess with resuming according to @mahesh-panchal

Version bump for v5.2.0 release [Puce Pangolin]

github-actions · 2025-11-05T12:27:52Z

`nf-core pipelines lint` overall result: Passed ✅ ⚠️

Posted for pipeline commit b04a935

+| ✅ 368 tests passed       |+
#| ❔   1 tests were ignored |#
!| ❗   8 tests had warnings |!

Details

❗ Test warnings:

nextflow_config - Config manifest.version should end in dev: 5.2.0
pipeline_todos - TODO string in main.nf: Remove this line if you don't need a FASTA file [TODO: try and test using for --host_fasta and --host_genome]
pipeline_todos - TODO string in methods_description_template.yml: #Update the HTML below to your preferred methods description, e.g. add publication citation for this pipeline
pipeline_todos - TODO string in main.nf: Optionally add in-text citation tools to this list.
pipeline_todos - TODO string in main.nf: Optionally add bibliographic entries to this list.
pipeline_todos - TODO string in main.nf: Only uncomment below if logic in toolCitationText/toolBibliographyText has been filled!
pipeline_todos - TODO string in nextflow.config: Specify any additional parameters here
actions_schema_validation - Failed to fetch schema: Response code for https://json.schemastore.org/github-workflow was 503

❔ Tests ignored:

files_unchanged - File ignored due to lint config: .github/PULL_REQUEST_TEMPLATE.md

✅ Tests passed:

files_exist - File found: .gitattributes
files_exist - File found: .gitignore
files_exist - File found: .nf-core.yml
files_exist - File found: .prettierignore
files_exist - File found: .prettierrc.yml
files_exist - File found: CHANGELOG.md
files_exist - File found: CITATIONS.md
files_exist - File found: CODE_OF_CONDUCT.md
files_exist - File found: LICENSE or LICENSE.md or LICENCE or LICENCE.md
files_exist - File found: nextflow_schema.json
files_exist - File found: nextflow.config
files_exist - File found: README.md
files_exist - File found: .github/.dockstore.yml
files_exist - File found: .github/CONTRIBUTING.md
files_exist - File found: .github/ISSUE_TEMPLATE/bug_report.yml
files_exist - File found: .github/ISSUE_TEMPLATE/config.yml
files_exist - File found: .github/ISSUE_TEMPLATE/feature_request.yml
files_exist - File found: .github/PULL_REQUEST_TEMPLATE.md
files_exist - File found: .github/workflows/branch.yml
files_exist - File found: .github/workflows/nf-test.yml
files_exist - File found: .github/actions/get-shards/action.yml
files_exist - File found: .github/actions/nf-test/action.yml
files_exist - File found: .github/workflows/linting_comment.yml
files_exist - File found: .github/workflows/linting.yml
files_exist - File found: assets/email_template.html
files_exist - File found: assets/email_template.txt
files_exist - File found: assets/sendmail_template.txt
files_exist - File found: assets/nf-core-mag_logo_light.png
files_exist - File found: conf/modules.config
files_exist - File found: conf/test.config
files_exist - File found: conf/test_full.config
files_exist - File found: docs/images/nf-core-mag_logo_light.png
files_exist - File found: docs/images/nf-core-mag_logo_dark.png
files_exist - File found: docs/output.md
files_exist - File found: docs/README.md
files_exist - File found: docs/README.md
files_exist - File found: docs/usage.md
files_exist - File found: nf-test.config
files_exist - File found: tests/default.nf.test
files_exist - File found: main.nf
files_exist - File found: assets/multiqc_config.yml
files_exist - File found: conf/base.config
files_exist - File found: conf/igenomes.config
files_exist - File found: conf/igenomes_ignored.config
files_exist - File found: .github/workflows/awstest.yml
files_exist - File found: .github/workflows/awsfulltest.yml
files_exist - File found: modules.json
files_exist - File found: ro-crate-metadata.json
files_exist - File not found check: .github/ISSUE_TEMPLATE/bug_report.md
files_exist - File not found check: .github/ISSUE_TEMPLATE/feature_request.md
files_exist - File not found check: .github/workflows/push_dockerhub.yml
files_exist - File not found check: .markdownlint.yml
files_exist - File not found check: .nf-core.yaml
files_exist - File not found check: .yamllint.yml
files_exist - File not found check: bin/markdown_to_html.r
files_exist - File not found check: conf/aws.config
files_exist - File not found check: docs/images/nf-core-mag_logo.png
files_exist - File not found check: lib/Checks.groovy
files_exist - File not found check: lib/Completion.groovy
files_exist - File not found check: lib/NfcoreTemplate.groovy
files_exist - File not found check: lib/Utils.groovy
files_exist - File not found check: lib/Workflow.groovy
files_exist - File not found check: lib/WorkflowMain.groovy
files_exist - File not found check: lib/WorkflowMag.groovy
files_exist - File not found check: parameters.settings.json
files_exist - File not found check: pipeline_template.yml
files_exist - File not found check: Singularity
files_exist - File not found check: lib/nfcore_external_java_deps.jar
files_exist - File not found check: .travis.yml
nextflow_config - Found nf-schema plugin
nextflow_config - Config variable found: manifest.name
nextflow_config - Config variable found: manifest.nextflowVersion
nextflow_config - Config variable found: manifest.description
nextflow_config - Config variable found: manifest.version
nextflow_config - Config variable found: manifest.homePage
nextflow_config - Config variable found: timeline.enabled
nextflow_config - Config variable found: trace.enabled
nextflow_config - Config variable found: report.enabled
nextflow_config - Config variable found: dag.enabled
nextflow_config - Config variable found: process.cpus
nextflow_config - Config variable found: process.memory
nextflow_config - Config variable found: process.time
nextflow_config - Config variable found: params.outdir
nextflow_config - Config variable found: params.input
nextflow_config - Config variable found: manifest.mainScript
nextflow_config - Config variable found: timeline.file
nextflow_config - Config variable found: trace.file
nextflow_config - Config variable found: report.file
nextflow_config - Config variable found: dag.file
nextflow_config - Config variable (correctly) not found: params.nf_required_version
nextflow_config - Config variable (correctly) not found: params.container
nextflow_config - Config variable (correctly) not found: params.singleEnd
nextflow_config - Config variable (correctly) not found: params.igenomesIgnore
nextflow_config - Config variable (correctly) not found: params.name
nextflow_config - Config variable (correctly) not found: params.enable_conda
nextflow_config - Config variable (correctly) not found: params.max_cpus
nextflow_config - Config variable (correctly) not found: params.max_memory
nextflow_config - Config variable (correctly) not found: params.max_time
nextflow_config - Config variable (correctly) not found: params.validationFailUnrecognisedParams
nextflow_config - Config variable (correctly) not found: params.validationLenientMode
nextflow_config - Config variable (correctly) not found: params.validationSchemaIgnoreParams
nextflow_config - Config variable (correctly) not found: params.validationShowHiddenParams
nextflow_config - Config variable (correctly) not found: validation.failUnrecognisedParams
nextflow_config - Config variable (correctly) not found: validation.failUnrecognisedHeaders
nextflow_config - Config timeline.enabled had correct value: true
nextflow_config - Config report.enabled had correct value: true
nextflow_config - Config trace.enabled had correct value: true
nextflow_config - Config dag.enabled had correct value: true
nextflow_config - Config manifest.name began with nf-core/
nextflow_config - Config variable manifest.homePage began with https://github.com/nf-core/
nextflow_config - Config dag.file ended with .html
nextflow_config - Config variable manifest.nextflowVersion started with >= or !>=
nextflow_config - Config params.custom_config_version is set to master
nextflow_config - Config params.custom_config_base is set to https://raw.githubusercontent.com/nf-core/configs/master
nextflow_config - Lines for loading custom profiles found
nextflow_config - nextflow.config contains configuration profile test
nextflow_config - Config default value correct: params.igenomes_base= s3://ngi-igenomes/igenomes/
nextflow_config - Config default value correct: params.custom_config_version= master
nextflow_config - Config default value correct: params.custom_config_base= https://raw.githubusercontent.com/nf-core/configs/master
nextflow_config - Config default value correct: params.publish_dir_mode= copy
nextflow_config - Config default value correct: params.max_multiqc_email_size= 25.MB
nextflow_config - Config default value correct: params.validate_params= true
nextflow_config - Config default value correct: params.pipelines_testdata_base_path= https://raw.githubusercontent.com/nf-core/test-datasets/
nextflow_config - Config default value correct: params.spades_fix_cpus= -1
nextflow_config - Config default value correct: params.spadeshybrid_fix_cpus= -1
nextflow_config - Config default value correct: params.metabat_rng_seed= 1
nextflow_config - Config default value correct: params.clip_tool= fastp
nextflow_config - Config default value correct: params.reads_minlength= 15
nextflow_config - Config default value correct: params.fastp_qualified_quality= 15
nextflow_config - Config default value correct: params.fastp_cut_mean_quality= 15
nextflow_config - Config default value correct: params.adapterremoval_minquality= 2
nextflow_config - Config default value correct: params.adapterremoval_adapter1= AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG
nextflow_config - Config default value correct: params.adapterremoval_adapter2= AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT
nextflow_config - Config default value correct: params.bbnorm_target= 100
nextflow_config - Config default value correct: params.bbnorm_min= 5
nextflow_config - Config default value correct: params.longreads_min_length= 1000
nextflow_config - Config default value correct: params.longreads_keep_percent= 90
nextflow_config - Config default value correct: params.longreads_length_weight= 10
nextflow_config - Config default value correct: params.longread_adaptertrimming_tool= porechop_abi
nextflow_config - Config default value correct: params.longread_filtering_tool= filtlong
nextflow_config - Config default value correct: params.gtdb_db= https://data.gtdb.aau.ecogenomic.org/releases/release226/226.0/auxillary_files/gtdbtk_package/full_package/gtdbtk_r226_data.tar.gz
nextflow_config - Config default value correct: params.gtdbtk_min_completeness= 50.0
nextflow_config - Config default value correct: params.gtdbtk_max_contamination= 10.0
nextflow_config - Config default value correct: params.gtdbtk_min_perc_aa= 10.0
nextflow_config - Config default value correct: params.gtdbtk_min_af= 0.65
nextflow_config - Config default value correct: params.gtdbtk_pplacer_cpus= 1
nextflow_config - Config default value correct: params.spades_downstreaminput= scaffolds
nextflow_config - Config default value correct: params.genomad_min_score= 0.7
nextflow_config - Config default value correct: params.genomad_splits= 1
nextflow_config - Config default value correct: params.binning_map_mode= group
nextflow_config - Config default value correct: params.bin_metabinner_scale= large
nextflow_config - Config default value correct: params.min_contig_size= 1500
nextflow_config - Config default value correct: params.min_length_unbinned_contigs= 1000000
nextflow_config - Config default value correct: params.max_unbinned_contigs= 100
nextflow_config - Config default value correct: params.bin_min_size= 0
nextflow_config - Config default value correct: params.bin_concoct_chunksize= 10000
nextflow_config - Config default value correct: params.bin_concoct_overlap= 0
nextflow_config - Config default value correct: params.bin_domain_classification_tool= tiara
nextflow_config - Config default value correct: params.tiara_min_length= 3000
nextflow_config - Config default value correct: params.busco_db_lineage= auto
nextflow_config - Config default value correct: params.checkm_download_url= https://zenodo.org/records/7401545/files/checkm_data_2015_01_16.tar.gz
nextflow_config - Config default value correct: params.checkm2_db_version= 14897628
nextflow_config - Config default value correct: params.refine_bins_dastool_threshold= 0.5
nextflow_config - Config default value correct: params.postbinning_input= raw_bins_only
nextflow_config - Config default value correct: params.gunc_database_type= progenomes
nextflow_config - Config default value correct: params.pydamage_accuracy= 0.5
nextflow_config - Config default value correct: params.freebayes_ploidy= 1
nextflow_config - Config default value correct: params.freebayes_min_basequality= 20
nextflow_config - Config default value correct: params.freebayes_minallelefreq= 0.33
nextflow_config - Config default value correct: params.bcftools_view_high_variant_quality= 30
nextflow_config - Config default value correct: params.bcftools_view_medium_variant_quality= 20
nextflow_config - Config default value correct: params.bcftools_view_minimal_allelesupport= 3
nf_test_content - 'tests/test_single_end.nf.test' contains outdir parameter
nf_test_content - 'tests/test_single_end.nf.test' snapshots a 'versions.yml' file
nf_test_content - 'tests/test_single_end.nf.test' snapshots a 'versions.yml' file
nf_test_content - 'tests/default.nf.test' contains outdir parameter
nf_test_content - 'tests/default.nf.test' snapshots a 'versions.yml' file
nf_test_content - 'tests/default.nf.test' snapshots a 'versions.yml' file
nf_test_content - 'tests/test_hybrid.nf.test' contains outdir parameter
nf_test_content - 'tests/test_hybrid.nf.test' snapshots a 'versions.yml' file
nf_test_content - 'tests/test_hybrid.nf.test' snapshots a 'versions.yml' file
nf_test_content - 'tests/test_minimal.nf.test' contains outdir parameter
nf_test_content - 'tests/test_minimal.nf.test' snapshots a 'versions.yml' file
nf_test_content - 'tests/test_minimal.nf.test' snapshots a 'versions.yml' file
nf_test_content - 'tests/test_assembly_input.nf.test' contains outdir parameter
nf_test_content - 'tests/test_assembly_input.nf.test' snapshots a 'versions.yml' file
nf_test_content - 'tests/test_assembly_input.nf.test' snapshots a 'versions.yml' file
nf_test_content - 'tests/test_longreadonly.nf.test' contains outdir parameter
nf_test_content - 'tests/test_longreadonly.nf.test' snapshots a 'versions.yml' file
nf_test_content - 'tests/test_longreadonly.nf.test' snapshots a 'versions.yml' file
nf_test_content - 'tests/test_longreadonly_alternatives.nf.test' contains outdir parameter
nf_test_content - 'tests/test_longreadonly_alternatives.nf.test' snapshots a 'versions.yml' file
nf_test_content - 'tests/test_longreadonly_alternatives.nf.test' snapshots a 'versions.yml' file
nf_test_content - 'tests/test_alternatives.nf.test' contains outdir parameter
nf_test_content - 'tests/test_alternatives.nf.test' snapshots a 'versions.yml' file
nf_test_content - 'tests/nextflow.config' contains modules_testdata_base_path
nf_test_content - 'tests/nextflow.config' contains pipelines_testdata_base_path
nf_test_content - 'nf-test.config' sets a testsDir
nf_test_content - 'nf-test.config' sets a workDir
nf_test_content - 'nf-test.config' sets a configFile
files_unchanged - .gitattributes matches the template
files_unchanged - .prettierrc.yml matches the template
files_unchanged - CODE_OF_CONDUCT.md matches the template
files_unchanged - LICENSE matches the template
files_unchanged - .github/.dockstore.yml matches the template
files_unchanged - .github/CONTRIBUTING.md matches the template
files_unchanged - .github/ISSUE_TEMPLATE/bug_report.yml matches the template
files_unchanged - .github/ISSUE_TEMPLATE/config.yml matches the template
files_unchanged - .github/ISSUE_TEMPLATE/feature_request.yml matches the template
files_unchanged - .github/workflows/branch.yml matches the template
files_unchanged - .github/workflows/linting_comment.yml matches the template
files_unchanged - .github/workflows/linting.yml matches the template
files_unchanged - assets/email_template.html matches the template
files_unchanged - assets/email_template.txt matches the template
files_unchanged - assets/sendmail_template.txt matches the template
files_unchanged - assets/nf-core-mag_logo_light.png matches the template
files_unchanged - docs/images/nf-core-mag_logo_light.png matches the template
files_unchanged - docs/images/nf-core-mag_logo_dark.png matches the template
files_unchanged - docs/README.md matches the template
files_unchanged - .gitignore matches the template
files_unchanged - .prettierignore matches the template
actions_nf_test - '.github/workflows/nf-test.yml' is triggered on expected events
actions_nf_test - '.github/workflows/nf-test.yml' checks minimum NF version
actions_awstest - '.github/workflows/awstest.yml' is triggered correctly
actions_awsfulltest - .github/workflows/awsfulltest.yml is triggered correctly
actions_awsfulltest - .github/workflows/awsfulltest.yml does not use -profile test
readme - README Nextflow minimum version badge matched config. Badge: 25.04.2, Config: 25.04.2
readme - README nf-core template version badge found.
readme - README Zenodo placeholder was replaced with DOI.
pipeline_if_empty_null - No ifEmpty(null) strings found
plugin_includes - No wrong validation plugin imports have been found
pipeline_name_conventions - Name adheres to nf-core convention
template_strings - Did not find any Jinja template strings (0 files)
schema_lint - Schema lint passed
schema_lint - Schema title + description lint passed
schema_lint - Input mimetype lint passed: 'text/csv'
schema_params - Schema matched params returned from nextflow config
system_exit - No System.exit calls found
merge_markers - No merge markers found in pipeline files
modules_json - Only installed modules found in modules.json
multiqc_config - assets/multiqc_config.yml found and not ignored.
multiqc_config - assets/multiqc_config.yml contains report_section_order
multiqc_config - assets/multiqc_config.yml contains export_plots
multiqc_config - assets/multiqc_config.yml contains report_comment
multiqc_config - assets/multiqc_config.yml follows the ordering scheme of the minimally required plugins.
multiqc_config - assets/multiqc_config.yml contains a matching 'report_comment'.
multiqc_config - assets/multiqc_config.yml contains 'export_plots: true'.
modules_structure - modules directory structure is correct 'modules/nf-core/TOOL/SUBTOOL'
local_component_structure - local subworkflows directory structure is correct 'subworkflows/local/TOOL/SUBTOOL'
base_config - conf/base.config found and not ignored.
base_config - BOWTIE2_HOST_REMOVAL_BUILD found in conf/base.config and Nextflow scripts.
base_config - BOWTIE2_HOST_REMOVAL_ALIGN found in conf/base.config and Nextflow scripts.
base_config - BOWTIE2_PHIX_REMOVAL_ALIGN found in conf/base.config and Nextflow scripts.
base_config - PORECHOP_PORECHOP found in conf/base.config and Nextflow scripts.
base_config - NANOLYSE found in conf/base.config and Nextflow scripts.
base_config - FILTLONG found in conf/base.config and Nextflow scripts.
base_config - CATPACK_BINS found in conf/base.config and Nextflow scripts.
base_config - CATPACK_CONTIGS found in conf/base.config and Nextflow scripts.
base_config - GTDBTK_CLASSIFYWF found in conf/base.config and Nextflow scripts.
base_config - MEGAHIT found in conf/base.config and Nextflow scripts.
base_config - METASPADES found in conf/base.config and Nextflow scripts.
base_config - METASPADESHYBRID found in conf/base.config and Nextflow scripts.
base_config - METAMDBG_ASM found in conf/base.config and Nextflow scripts.
base_config - FLYE found in conf/base.config and Nextflow scripts.
base_config - BOWTIE2_ASSEMBLY_ALIGN found in conf/base.config and Nextflow scripts.
base_config - METABAT2_METABAT2 found in conf/base.config and Nextflow scripts.
base_config - MAG_DEPTHS found in conf/base.config and Nextflow scripts.
base_config - MAG_DEPTHS_PLOT found in conf/base.config and Nextflow scripts.
base_config - BUSCO_BUSCO found in conf/base.config and Nextflow scripts.
base_config - MAXBIN2 found in conf/base.config and Nextflow scripts.
base_config - COMEBIN_RUNCOMEBIN found in conf/base.config and Nextflow scripts.
base_config - METABINNER_METABINNER found in conf/base.config and Nextflow scripts.
base_config - DASTOOL_DASTOOL found in conf/base.config and Nextflow scripts.
base_config - CHECKM_LINEAGEWF found in conf/base.config and Nextflow scripts.
base_config - CHECKM2_PREDICT found in conf/base.config and Nextflow scripts.
modules_config - conf/modules.config found and not ignored.
modules_config - FASTQC_RAW found in conf/modules.config and Nextflow scripts.
modules_config - FASTP found in conf/modules.config and Nextflow scripts.
modules_config - TRIMMOMATIC found in conf/modules.config and Nextflow scripts.
modules_config - ADAPTERREMOVAL_PE found in conf/modules.config and Nextflow scripts.
modules_config - ADAPTERREMOVAL_SE found in conf/modules.config and Nextflow scripts.
modules_config - BOWTIE2_PHIX_REMOVAL_ALIGN found in conf/modules.config and Nextflow scripts.
modules_config - BOWTIE2_HOST_REMOVAL_ALIGN found in conf/modules.config and Nextflow scripts.
modules_config - FASTQC_TRIMMED found in conf/modules.config and Nextflow scripts.
modules_config - BBMAP_BBNORM found in conf/modules.config and Nextflow scripts.
modules_config - PORECHOP_PORECHOP found in conf/modules.config and Nextflow scripts.
modules_config - PORECHOP_ABI found in conf/modules.config and Nextflow scripts.
modules_config - FILTLONG found in conf/modules.config and Nextflow scripts.
modules_config - NANOQ found in conf/modules.config and Nextflow scripts.
modules_config - NANOLYSE found in conf/modules.config and Nextflow scripts.
modules_config - CHOPPER found in conf/modules.config and Nextflow scripts.
modules_config - NANOPLOT_RAW found in conf/modules.config and Nextflow scripts.
modules_config - NANOPLOT_FILTERED found in conf/modules.config and Nextflow scripts.
modules_config - MINIMAP2_HOST_INDEX found in conf/modules.config and Nextflow scripts.
modules_config - MINIMAP2_HOST_ALIGN found in conf/modules.config and Nextflow scripts.
modules_config - MINIMAP2_ASSEMBLY_ALIGN found in conf/modules.config and Nextflow scripts.
modules_config - SAMTOOLS_HOSTREMOVED_UNMAPPED found in conf/modules.config and Nextflow scripts.
modules_config - SAMTOOLS_HOSTREMOVED_STATS found in conf/modules.config and Nextflow scripts.
modules_config - MEGAHIT found in conf/modules.config and Nextflow scripts.
modules_config - METASPADES found in conf/modules.config and Nextflow scripts.
modules_config - METASPADESHYBRID found in conf/modules.config and Nextflow scripts.
modules_config - FLYE found in conf/modules.config and Nextflow scripts.
modules_config - METAMDBG_ASM found in conf/modules.config and Nextflow scripts.
modules_config - QUAST found in conf/modules.config and Nextflow scripts.
modules_config - QUAST_BINS found in conf/modules.config and Nextflow scripts.
modules_config - GENOMAD_ENDTOEND found in conf/modules.config and Nextflow scripts.
modules_config - BOWTIE2_ASSEMBLY_ALIGN found in conf/modules.config and Nextflow scripts.
modules_config - MAG_DEPTHS_PLOT found in conf/modules.config and Nextflow scripts.
modules_config - BIN_SUMMARY found in conf/modules.config and Nextflow scripts.
modules_config - BUSCO_UNTAR found in conf/modules.config and Nextflow scripts.
modules_config - BUSCO_BUSCO found in conf/modules.config and Nextflow scripts.
modules_config - CHECKM_UNTAR found in conf/modules.config and Nextflow scripts.
modules_config - CHECKM_LINEAGEWF found in conf/modules.config and Nextflow scripts.
modules_config - CHECKM_QA found in conf/modules.config and Nextflow scripts.
modules_config - CONCAT_BUSCO_TSV found in conf/modules.config and Nextflow scripts.
modules_config - CHECKM2_DATABASEDOWNLOAD found in conf/modules.config and Nextflow scripts.
modules_config - CHECKM2_PREDICT found in conf/modules.config and Nextflow scripts.
modules_config - GUNC_DOWNLOADDB found in conf/modules.config and Nextflow scripts.
modules_config - GUNC_RUN found in conf/modules.config and Nextflow scripts.
modules_config - GUNC_MERGECHECKM found in conf/modules.config and Nextflow scripts.
modules_config - CATPACK_PREPARE found in conf/modules.config and Nextflow scripts.
modules_config - CATPACK_BINS found in conf/modules.config and Nextflow scripts.
modules_config - CATPACK_ADDNAMES_BINS found in conf/modules.config and Nextflow scripts.
modules_config - CATPACK_SUMMARISE_BINS found in conf/modules.config and Nextflow scripts.
modules_config - CATPACK_UNBINS found in conf/modules.config and Nextflow scripts.
modules_config - CATPACK_ADDNAMES_UNBINS found in conf/modules.config and Nextflow scripts.
modules_config - CATPACK_SUMMARISE_UNBINS found in conf/modules.config and Nextflow scripts.
modules_config - GTDBTK_CLASSIFYWF found in conf/modules.config and Nextflow scripts.
modules_config - GTDBTK_SUMMARY found in conf/modules.config and Nextflow scripts.
modules_config - PROKKA found in conf/modules.config and Nextflow scripts.
modules_config - PRODIGAL found in conf/modules.config and Nextflow scripts.
modules_config - FREEBAYES found in conf/modules.config and Nextflow scripts.
modules_config - BCFTOOLS_VIEW found in conf/modules.config and Nextflow scripts.
modules_config - BCFTOOLS_CONSENSUS found in conf/modules.config and Nextflow scripts.
modules_config - BCFTOOLS_INDEX found in conf/modules.config and Nextflow scripts.
modules_config - PYDAMAGE_ANALYZE found in conf/modules.config and Nextflow scripts.
modules_config - PYDAMAGE_FILTER found in conf/modules.config and Nextflow scripts.
modules_config - SAMTOOLS_FAIDX found in conf/modules.config and Nextflow scripts.
modules_config - METABAT2_JGISUMMARIZEBAMCONTIGDEPTHS_SHORTREAD found in conf/modules.config and Nextflow scripts.
modules_config - METABAT2_JGISUMMARIZEBAMCONTIGDEPTHS_LONGREAD found in conf/modules.config and Nextflow scripts.
modules_config - METABAT2_METABAT2 found in conf/modules.config and Nextflow scripts.
modules_config - MAXBIN2 found in conf/modules.config and Nextflow scripts.
modules_config - ADJUST_MAXBIN2_EXT found in conf/modules.config and Nextflow scripts.
modules_config - CONCOCT_CUTUPFASTA found in conf/modules.config and Nextflow scripts.
modules_config - CONCOCT_ found in conf/modules.config and Nextflow scripts.
modules_config - COMEBIN_RUNCOMEBIN found in conf/modules.config and Nextflow scripts.
modules_config - METABINNER_KMER found in conf/modules.config and Nextflow scripts.
modules_config - METABINNER_TOOSHORT found in conf/modules.config and Nextflow scripts.
modules_config - METABINNER_METABINNER found in conf/modules.config and Nextflow scripts.
modules_config - METABINNER_BINS found in conf/modules.config and Nextflow scripts.
modules_config - SEQKIT_STATS found in conf/modules.config and Nextflow scripts.
modules_config - SPLIT_FASTA found in conf/modules.config and Nextflow scripts.
modules_config - DASTOOL_FASTATOCONTIG2BIN_METABAT2 found in conf/modules.config and Nextflow scripts.
modules_config - DASTOOL_FASTATOCONTIG2BIN_MAXBIN2 found in conf/modules.config and Nextflow scripts.
modules_config - DASTOOL_FASTATOCONTIG2BIN_CONCOCT found in conf/modules.config and Nextflow scripts.
modules_config - DASTOOL_FASTATOCONTIG2BIN_COMEBIN found in conf/modules.config and Nextflow scripts.
modules_config - DASTOOL_FASTATOCONTIG2BIN_TIARA found in conf/modules.config and Nextflow scripts.
modules_config - DASTOOL_DASTOOL found in conf/modules.config and Nextflow scripts.
modules_config - RENAME_POSTDASTOOL found in conf/modules.config and Nextflow scripts.
modules_config - TIARA_TIARA found in conf/modules.config and Nextflow scripts.
modules_config - TIARA_CLASSIFY found in conf/modules.config and Nextflow scripts.
modules_config - TIARA_SUMMARY found in conf/modules.config and Nextflow scripts.
modules_config - MMSEQS_DATABASES found in conf/modules.config and Nextflow scripts.
modules_config - METAEUK_EASYPREDICT found in conf/modules.config and Nextflow scripts.
modules_config - MULTIQC found in conf/modules.config and Nextflow scripts.
nfcore_yml - Repository type in .nf-core.yml is valid: pipeline
nfcore_yml - nf-core version in .nf-core.yml is set to the latest version: 3.4.1
rocrate_readme_sync - RO-Crate descriptions are in sync with README.md.

Run details

nf-core/tools version 3.4.1
Run at 2025-11-07 12:52:40

jfy133 · 2025-11-05T12:58:37Z

Ugh that same conda issue again... I still can't work out wtf is going on with geNomad and conda 🫠

dialvarezs · 2025-11-05T15:12:48Z

Ugh that same conda issue again... I still can't work out wtf is going on with geNomad and conda 🫠

The issue seems to be with package itself?
I tried installing it on a fresh environment and it doesn't matter if I install 1.11.0 or 1.11.1, the version is always 1.9.4
Even with pixi

jfy133 · 2025-11-05T18:07:02Z

Ugh that same conda issue again... I still can't work out wtf is going on with geNomad and conda 🫠
The issue seems to be with package itself?

I tried installing it on a fresh environment and it doesn't matter if I install 1.11.0 or 1.11.1, the version is always 1.9.4
Even with pixi

Checking the referenced PR: oooohhh THATS where it came from! I could never work out where the 1.9.4 came from as was not in the genomad code at all !!!

I should really learn python 😅

dialvarezs · 2025-11-05T18:13:24Z

I'm updating the genomad nf-core module to use rich-click 1.8.x as a temporary fix.

Update genomad modules

prototaxites · 2025-11-06T09:50:44Z

Looking good!

Update release announcement action

Fix BUSCO publishing

Apply #910 review suggestions

dialvarezs and others added 30 commits October 6, 2025 17:58

Update metabat2

423d2cf

Fix BUSCO version in changelog

ea49e63

Fix metabat2 snaps

ddac1be

Add new nf-test configs

2fce6a9

Old config cleanup

0c671c9

Update changelog

b6934ea

Use large disk to prevent storage issues

afac435

Add missing versions mixing and move version calls after each module …

ff76d4f

…invocation for consistency

Final version fixes and moving

abd671f

Update CHANGELOG

743e6ae

Update subworkflows/local/assembly_longread/main.nf

d292e39

Co-authored-by: Jim Downie <[email protected]>

Replace sceond long ternary with proper if-else

32a746c

Remove if/else statement and revert to ternary because cannot otherwi…

ccceab3

…se assign to `mode:` accroding to Nextflow LSP

Remove .first() from everywhere as not necessary and can mess with …

c476a2e

…resuming according to @mahesh-panchal

Revert "Remove .first() from everywhere as not necessary and can me…

140335d

…ss with resuming according to @mahesh-panchal" This reverts commit 4a1d438.

Correctly remove .first() from everywhere as not necessary and can …

6298686

…mess with resuming according to @mahesh-panchal

Use simplified corutils version catch from @mahesh-panchal

7e07848

Fix wrong version placement

0928873

Use correct flags for flye and update some snapshots

c8f41e5

Typo fix for metaMDG option

2ef408e

Fix autoformatting

8aa3112

Use correc tyaml

7c2aa9d

Update snapshots

f8875f0

Add multiqc snapshots

e6c346c

Update hybrid

895962c

Update snapshots

b953b06

Update snapshot

6362a31

Standardise header sand tags

f8d6122

Use porechop_porechop in test_hbyrid profile

5bd4245

update snapshot to include correct tool

1794ac8

dialvarezs added 4 commits November 4, 2025 16:04

Fix rocrate

7cc714c

Include names in changelog

ddb8c81

Updated metro maps by @jfy133

7d0fe05

Merge pull request #913 from dialvarezs/prerelease-version-bump-5.2.0

6a848cd

Version bump for v5.2.0 release [Puce Pangolin]

dialvarezs marked this pull request as ready for review November 5, 2025 12:25

dialvarezs requested review from d4straub, jfy133, muabnezor and prototaxites as code owners November 5, 2025 12:25

dialvarezs mentioned this pull request Nov 5, 2025

Fix version reporting in CLI apcamargo/genomad#167

Merged

dialvarezs mentioned this pull request Nov 5, 2025

Update genomad module nf-core/modules#9347

Merged

17 tasks

dialvarezs and others added 2 commits November 5, 2025 22:26

Update genomad modules

789b0f6

Merge pull request #918 from dialvarezs/update-genomad

ba695d7

Update genomad modules

prototaxites approved these changes Nov 6, 2025

View reviewed changes

dialvarezs added 5 commits November 6, 2025 08:24

Update release announcement action

d8b2f87

Merge pull request #919 from dialvarezs/update-actions

4c7ac9d

Update release announcement action

Fix BUSCO publishing

69ad3e3

Update CHANGELOG

714d9f0

Merge pull request #921 from dialvarezs/fix-busco-publishing

053cd4d

Fix BUSCO publishing

Aratz self-requested a review November 7, 2025 10:00

Aratz approved these changes Nov 7, 2025

View reviewed changes

Comment thread modules/local/metabinner_kmer/main.nf

Comment thread subworkflows/local/utils_nfcore_mag_pipeline/main.nf Outdated

dialvarezs added 2 commits November 7, 2025 09:18

Apply review suggestions

64caac5

Merge pull request #922 from dialvarezs/review-suggestions

b04a935

Apply #910 review suggestions

dialvarezs merged commit 99859fc into main Nov 7, 2025
100 of 106 checks passed

Provide feedback

Saved searches

Use saved searches to filter your results more quickly

Release: v5.2.0 Puce Pangolin#914

Release: v5.2.0 Puce Pangolin#914
dialvarezs merged 318 commits intomainfrom
dev

dialvarezs commented Nov 5, 2025 •

edited

Loading

Uh oh!

github-actions Bot commented Nov 5, 2025 •

edited

Loading

❗ Test warnings:

❔ Tests ignored:

✅ Tests passed:

Run details

Uh oh!

jfy133 commented Nov 5, 2025

Uh oh!

dialvarezs commented Nov 5, 2025 •

edited

Loading

Uh oh!

jfy133 commented Nov 5, 2025

Uh oh!

dialvarezs commented Nov 5, 2025 •

edited

Loading

Uh oh!

prototaxites commented Nov 6, 2025

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Reviewers

Assignees

Labels

Projects

Milestone

Development

Uh oh!

9 participants

Conversation

dialvarezs commented Nov 5, 2025 • edited Loading Uh oh! There was an error while loading. Please reload this page.

Uh oh!

Added

Changed

Fixed

Dependencies

Deprecated

PR checklist

Uh oh!

github-actions Bot commented Nov 5, 2025 • edited Loading Uh oh! There was an error while loading. Please reload this page.

Uh oh!

nf-core pipelines lint overall result: Passed ✅ ⚠️

❗ Test warnings:

❔ Tests ignored:

✅ Tests passed:

Run details

Uh oh!

jfy133 commented Nov 5, 2025

Uh oh!

dialvarezs commented Nov 5, 2025 • edited Loading Uh oh! There was an error while loading. Please reload this page.

Uh oh!

Uh oh!

jfy133 commented Nov 5, 2025

Uh oh!

dialvarezs commented Nov 5, 2025 • edited Loading Uh oh! There was an error while loading. Please reload this page.

Uh oh!

Uh oh!

prototaxites commented Nov 6, 2025

Uh oh!

Uh oh!

Uh oh!

Uh oh!

Reviewers

Assignees

Labels

Projects

Milestone

Development

Uh oh!

9 participants

dialvarezs commented Nov 5, 2025 •

edited

Loading

`Added`

`Changed`

`Fixed`

`Dependencies`

`Deprecated`

github-actions Bot commented Nov 5, 2025 •

edited

Loading

`nf-core pipelines lint` overall result: Passed ✅ ⚠️

dialvarezs commented Nov 5, 2025 •

edited

Loading

dialvarezs commented Nov 5, 2025 •

edited

Loading